[M-270 strepavidin Dyabeads (Invitrogen), Magna-Sep magnetic particle separator (Invitrogen)]
(a) Resuspend streptavidin bead stock by light vortexing
(b) Pipet 20 µl beads to 1.5ml microfuge tube for each capture
(c) Place in magnetic tube rack, wait for beads to move to side (~1 min), remove supernatant
(d) Wash beads by adding 100 µl RecA binding buffer
(e) Repeat steps 3-5 two more times for a total of 3 washes
(f) Resuspend beads in 30 µl RecA binding buffer
[RecA protein 2mg/ml (New England Biolabs), Adenosine 5’-triphosphate 100mM (Sigma-Aldrich), Adenosine 5’-[g-thiol] triphospate tetralithium salt (Sigma-Aldrich), Proteinase K (New England Biolabs), Phenylmethyl sulfonyl fluoride (PMSF) (Sigma-Aldrich)]
(a) Calculate the volume needed for 5µg cDNA from each library to be captured, total volume is 30µl
(b) Add the following reagents, in order, to a 1.5ml microcentrifuge tube for each capture
Volume/tube | Reagent |
(see above) | water |
0.6 µl | CoCl2 (0.1 M, stored room temperature) |
3 µl |
10X RecA capture buffer (stored -20°C) |
0.5 µl |
Probe (100 ng/µl stock stored -20°C) |
2.0 µl |
RecA (stored -20°) |
0.9 µl |
ATP mix (100mM, stored -80°C) |
Probe: 5’-CGGAGATCAYRCTGACVTGGC-3’
The sequence of the capture oligonucleotide was derived from a highly conserved region of the MHC class I alpha-3 domain
(c) Mix well by pipetting, quick spin in a microcentrifuge
(d) Incubate for 15 min at 37°C
(e) Add appropriate volume of cDNA
(f) Incubate 20 min at 37°C
(g) Add 0.6 µl 10% SDS to each tube
(h) Add 0.5 µl Proteinase K to each tube
(i) Incubate 10 min at 37°C
(j) Add 1.0 µl PMSF (100mM, stored -20°C) to each tube
(k) Add 30 µl resuspended beads to each tube
(l) Incubate 30 min at room temperature, resuspending beads every 2 minutes by light tapping
(m) Place each tube in the magnetic separator for 2 minutes
(n) Remove supernatant
(o) Resuspend beads in 1 ml of RecA wash buffer, mix thoroughly by inverting for 1 minute
(p) Repeat steps (m)-(o)
(q) Repeat steps (m) and (n) for a total of 3 washes
(r) Add 1 ml of 37°C nuclease free H2O and incubate for 5 minutes
(s) Repeat steps (m) and (o)
(t) Resuspend beads in 400 µl TE (10mM Tris,1mM EDTA, pH8.0)
[Glycogen (20ug/ul) (Invitrogen), Phenol:Chloroform:Isoamyl alcohol 25:24:1 (Sigma-Aldrich)]
(a) Add 400 µl phenol:chloroform:isoamyl:alcohol (best done in a screw-top microcentrifuge tube)
(b) Vortex hard for 15 seconds
(c) Spin for 5 min at 14000g
(d) Remove the upper aqueous layer and transfer to fresh tube
(e) Magnetically separate any remaining beads and transfer to a new tube
(f) Add 100 µl 10M NH4OAc; 1 µl glycogen, and 1ml of -20°C absolute ethanol
(g) Spin for 20 min at 14000g
(h) Carefully remove supernatant leaving pellet, wash with 500µl 70% EtOH, spin for 10 min at 14000g
(i) Remove supernatant and allow pellet to air dry
(j) Resuspend in 10 µl TE
[DH5-a competent E.coli (Invitrogen)]
(a) Thaw 1 aliquot of DH5-a competent cells on ice
(b) Add 5 µl of RecA capture enriched cDNA from step 3 (j) and mix gently
(c) Incubate for 5 min on ice
(d) Heat shock for 30 sec at 42° C
(e) Incubate for 5 min on ice
(f) Add 250 µl of 37° SOC medium
(g) Incubate for 1 hr with shaking at 37°C
(h) Plate 75-150 µl per plate (15 cm petri dishes), grow overnight at 34° C.
[Perfectprep Plasmid 96 Vac Direct Bind kit (Eppendorf), CIRCLEGROW broth powder (Qbiogene)]
(a) Pick single colonies and grow overnight in 1ml CircleGrow broth with 100µg/ml ampicillin
(b) Isolate Plasmid cDNA according to the manufacturer’s protocol
[DYEnamicTM ET Terminator Cycle Sequencing Kit (GE Healthcare), CleanSEQ_ Dye-Terminator Removal Kit (Agencourt), 85% ethanol (EtOH)]
(a) Prepare a 5 mM MgCl2, 20 mM Tris sequencing buffer by adding 0.102 g MgCl2 and 0.242 g Tris to 80 ml double-distilled water, stir to dissolve, adjust pH to 9.0, and bring volume to 100 ml with double-distilled water.
(b) Prepare sequencing reaction mix containing 1 µl DYEnamicTM ET Terminator, 1 µl 3.2 µM oligo (either 5’Refstrand or SBT190-R), 6 µl sequencing buffer, 7 µl nuclease-free water, and 5 µl purified plasmid DNA.
(c) Cycle sequence using the following thermocycler profile: 30 cycles of 95 °C for 20 s, 50 °C for 15 s, and 60 °C for 1 min.
(d) Purify the sequencing reactions using the Agencourt_ CleanSEQ_ Dye-Terminator Removal kit following the manufacturer’s protocol for ET Terminator clean-up.
(e) Resolve the cleaned sequencing products by capillary electrophoresis on an ABI 3730 Genetic Analyzer (Applied Biosystems), or a comparable Sanger sequencing platform.
Primers used to sequence MHC class II alleles:
Forward primers:
Primer name | Primer sequence (5’- 3’) |
SP6 |
GGCCTATTTAGGTGACACTATAG |
C/1+ |
GCAGATACCTGGAGAACGGG |
IV |
GGAACCTTCCAGAAGTGGG |
3’UTR |
CAGGGCTCTGATGTGTCTCTCACG |
Reverse primers:
Primer name | Primer sequence (5’- 3’) |
T7 |
TAATACGACTCACTATAGGG |
E2 |
CYCCACCTCCTCACATKATGC |
F1 |
CCAGGTCAGTGTGATCTCCG |
G1 |
ATGTAATCCTTGCCGTCGTA |
Sequences were analyzed using CodonCode Aligner version 1.6.3 (CodonCode, Deadham, MA). MHC class I alleles were considered part of the cDNA library after at least two copies were verified by sequencing. Novel MHC I sequences were given GenBank accession numbers.
A. Probes:
Probes must be ≥40 nucleotides long.
They should be biotinylated at the 5' end and HPLC or PAGE purified
Resuspend at 100 ng/µl
B. 10X RecA capture buffer:
12.5 ml 1.0M Tris acetate pH 7.5
0.43 g MgOAc
0.5 g BSA
q.s. to 50 ml with H2O
Final concentration for 10x: 250nM Tris Acetate, 40mM MgOAc, 10µg/µl BSA
C. ATP mixture:
2 parts 100 mM adenosine 5’-[g-thiol] triphosphate tetralithium salt (ATP gamma S)
1 part 100 mM adenosine triphosphate
D. RecA binding buffer:
2.92 g NaCl
500 µl 1M Tris Acetate, pH 7.5
100 µl 0.5 M EDTA, pH 8.0
50 ml millipore H2O
Final Concentration: 10mM Tris, 1 mM EDTA, 1M NaCl
E. RecA wash buffer:
5.84 g NaCl
500 µl 1M Tris Acetate pH 7.5
100 µl 0.5 M EDTA pH 8.0
50 ml millipore H2O
Final Concentration: 10mM Tris, 1 mM EDTA, 1M NaCl
Attached Files | ||